Downloadable pdf of this website

Serotonin Transporter (5HTT, Locus Symbol SLC6A4), which maps to 17q11.1-17q12 (Ramamoorthy et al., 1993), contains a 43 bp insertion/deletion (ins/del, 5HTTLPR) polymorphism in the 5’ regulatory region of the gene (Heils et al., 1996). It should be noted that due to an error in sequencing this was originally thought to be a 44 bp deletion (the highly repetitive nature of this site makes this a very excusable error). The ins/del in the promoter appears to be associated with variations in transcriptional activity: the long variant (L) has approximately three times the basal activity of the short promoter (S) with the deletion (Lesch et al., 1996), although this is not a universal finding (Willeit et al., 2001, Kaiser et al., 2002). The S variant has been reported to be dominant over the L variant (Heils et al., 1996), although at least one report suggests that the L may be dominant over the S (Williams et al, 2003).  Several investigators have reported that the 5-HTTLPR polymorphism affects serotonergic functions in vivo.  Individuals with the L/L genotype were found to have significantly higher maximal uptake of serotonin into platelets compared to those with L/S or S/S genotypes (Nobile et al., 1999, Greenberg et al., 1999). 

A depiction of the organization of the serotonin transporter showing the 5HTTLPR region and the positions of several SNPs that will be used in other analyses.
Adapted from Heils et al, 1996 and Lesch et al, 1996.

 

The assay we use for the 5HTTLPR (Anchordoquy et al, 2003) is a modification of the method of Lesh et al, (1996). The primer sequences are from Gelernter et al. (1999).

Forward: 5’- 6FAM - ATG CCA GCA CCT AAC CCC TAA TGT - 3’, 
Reverse:  5’- GGA CCG CAA GGT GGG CGG GA - 3’.
           
            These primers yield amplicons of 419 (L) or 376 (S) bp.

 

5HTTLPR PCR Master Mix for 20 µL reactions
(18 µL Master mix + 2 µL DNA)

Component	1 Tube vol (µL)	100 Tubes vol (µL)	Concentration of component in:
			Stock	Master Mix	PCR
Water	9.3	930
DMSO	2.0	200	100%	10.9 %	10%
10x Buffer II	2.0	200	10 x	0.109 x	1 x
MgCl2	1.6	160	25 mM	2.18mM	2.00 mM
dNTP+deazaGTP	2.0	200	2 mM (ea)	218 µM	200 µM (ea)
Forward	0.65	65	12 µM	425 µM	380 µM
Reverse	0.65	65	12 µM	425 µM	380 µM
AmpliTaq Gold®	0.2	20	5 units/µL	1 unit	1.0 unit
Total volume (µL)	18.4	1840

 

Preparation of dNTPs + 7-deaza-2-deoxy GTP

		Concentration (mM)
Component	volume (µL)	Stock	Final
dATP	40	100	2
dTTP	40	100	2
dCTP	40	100	2
dGTP	20	100	1
deazaGTP	200	10	1
Water	1660

 

5HTTLPR PCR Setup

Mastermix	18 µL
DNA	1-2 µL  (20 ng or less)
Water	0-1 µL
Total volume	20 µL

 

5HTTLPR Touchdown PCR Cycling

1x	95 °C   10 min
1x	95 °C   30 sec	65 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	64 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	63 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	62 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	61 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	90 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	59 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	58 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	57 °C   30 sec	72 °C  90 sec
1x	95 °C   30 sec	56 °C   30 sec	72 °C  90 sec
30x	90 °C   30 sec	55 °C   30 sec	72 °C  90 sec
1x	72 °C   30 min
	4 °C   hold

                                               
5HTTLPR Electrophoresis

2 µL PCR product
20 µL Hi-Di formamide
0.5 µL Genescan 500 (or 2500) Rox

Samples are analyzed on an ABI PRISM® 3130xl Genetic Analyzer using standard company protocols without modification                

 

The table below lists the frequencies of the two alleles in approximately
1000 subjects taken from the National Youth Survey Family Study.
These are typical for a largely Caucasian population such as this.

Amplicon Size	Allele	Frequency
376	short	.43
419	long	.57

Notes:

For consistent results with this primer set the use of 10% DMSO and 7-deaza-2-deoxy GTP (Roche Applied Science, Indianapolis, IN) is essential.

Use a very good grade of DMSO. We use Sigma’s Hybra-Max® grade or that supplied with New England Biolab’s Phusion™ buffers.

We use touchdown PCR (Don et al, 1992) routinely as a simple short cut. It cuts down on the need to optimize annealing conditions for multiple primer sets when you want to do several loci in the same thermocycler.

There are many papers on this polymorphism, which can lead to confusion at first. Depending on the primer sets used and the nomenclature the authors use, the sizes of the reported long and short alleles may be different. Ours, using the primers reported by Gelernter et al (1999) are 376 and 419 bp. Heils et al (1996 ) report 484 and 528 bp; Wendland et al (2006) report 469 and 512 bp; and Nakamura et al (2000) refer to them as 14- and 16-repeat alleles. These are all the same.

rs25531 SNP (MspI, LA / LG)

Hu et al (2006) reported that a SNP (rs25531, A/G) in the Long form of 5HTTLPR may have functional significance: The more common LA allele is associated with the reported higher basal activity, whereas the less common LG allele has transcriptional activity no greater than the S. These investigators suggest that in tests of association the LG alleles should be analyzed along with the S alleles.

The substitution of the G for A in the SNP, produces and MspI restriction site (CCGG) which forms the basis of the analysis strategy (Wendland et al, 2006). The sequence of the 5HTTLPR region was first reported by Heils, et al,  and is reproduced below in the way they did to show the highly repetitive nature of the locus. There were two errors in their sequence in repeat units III and V (underlined) that have been corrected here. The forward and reverse primers we use now that yield amplicons of 376 and 419 bp, are shown in yellow highlight. The SNP, rs25531 is shown as “R” in green highlight and the second MspI site in repeat unit XIV is shown in teal highlight. The insertion/deletion is shown underlined in lower case in repeat units VI, VII, and VIII.

TCTCCCGCCTGGCGTTGCCGCTCTGAATGCCAGCACCTAACCCCTAATGT

I	CCCTAC TGCA GCCCCCCC AGCAT
II	CCCCCC TGCA ACCTCCC  AGCA
III	ACTCCC TGTA CCCCTCCT AGGAT
IV	CGCTCC TGCA TCCCCC   ATTATC
V	CCCCCC TTCA CCCCTCGC GGCAT
VI	CCCCCC TGCA ccccc    Rgcat   R = A or G
VII	cccccc tgca gccccccc agcat
VIII	ctcccc tgca CCCCC    AGCAT
IX	CCCCCC TGCA GCCCTTCC AGCA
X	TCCCCC TGCA CCTCTCCC AGGAT
XI	CTCCCC TGCA ACCCCC   ATTAT
XII	CCCCCC TGCA CCCCTCGC AGTAT
XIII	CCCCCC TGCA CCCCCC   AGCATC
XIV	CCCCCA TGCA CCCCC    GGCAT
XV	CCCCCC TGCA CCCCTCC  AGCAT
XVI	TCTCCT TGCA CCCTACC  AGTAT

TCCCCCGCATCCCGGCCTCCAAGCCTCCCGCCCACCTTGCGGTCCCCGCC

 
The forward primer has a fluorescent label attached to it’s 5’ end.  To analyze this SNP, the full length amplicons (from above) are incubated with the restriction enzyme MspI. The G allele which has the MspI restriction site (CCGG) will yield a product of 152 bp, whereas the A allele, which lacks the restriction site does not.  A second MspI site 93 bp from the 3’ end of the amplicon provides a positive control for the restriction reaction yielding cut products of 326 or 283 bp for the L and S alleles, respectively.

To summarize, LG alleles yield 152 bp fragments, LA alleles yield 326 bp fragments and S alleles yield 283 bp fragments when incubated with MspI. For the following genotypes, the results for the PCR reaction, followed by MspI digest would be:

	PCR	MspI
LA/LA	419/419	326/326
LG/LG	419/419	152/152
LG/LA	419/419	152/326
S/S	376/376	283/283
S/LA	376/419	283/326
S/LG	376/419	283/152

You may notice that there is a third MspI site 30 bp from the end of the amplicon. This never shows up. Since the enzyme cleaves all of the sites equally well, only the smallest fragment with the 5’ fluorescent label is visualized. If you were to run these cut products on an agorose gel, all could be visualized with ethidium bromide or other dye.
To analyze this SNP, the PCR products from above are used. After determining the genotype of the samples from above (e.g., LL, LS or SS), the PCR plate is prepared for MspI (#R106L, NEB, Ipswitch, MA) restriction digest
                       
                                                Sample Preparation for MspI Digest

95 °C	10 min
65 °C	30 min
4 °C	hold

 

MspI Restriction Digest Master Mix for 10 µL reactions
(8 µL Master mix + 2 µL PCR product)

Component	1 Tube vol (µL)	100 Tubes vol (µL)	Concentration of component in:
			Stock	Master Mix	Reaction
Water	6.8	680
NEB buffer 2	1.0	100	10x	0.125x	1x
MspI	0.2	20	20 units/µL	4 units	4 units
Total volume (µL)	8.0	800

           

MspI Digest Protocol

8 µL of master mix + 2µL 5HTTLPR PCR product

37 °C	3 hours
65 °C	20 min
4 °C	hold

 

 

MspI Digest  Electrophoresis

Size standard mixture for 100 samples:

500  µL water
500  µL Hi-Di formamide
25 µL Genescan 500  Rox

Add 1 µL digest product to 9 µL size standard mix

Samples are analyzed on an ABI PRISM® 3130xl Genetic Analyzer using standard company protocols without modification

 

Citation: When reporting results for this locus, please cite Anchordoquy et al, 2003 as the analytical method used for genotyping.

References:

Anchordoquy, H. C., McGeary, C., Liu, L., Krauter, K.S. and Smolen, A. (2003). Genotyping of three candidate genes following whole genome preamplification of DNA collected from buccal cells. Behavior  Genetics. 33: 73-78.

Don, R.H., Cox, P.T., Wainwright, B.J., Baker, K. and Mattick, J.S. (1992). “Touchdown” PCR to circumvent spurious priming during gene amplification.  Nucleic Acids Research. 19: 4008.

Gelernter, J., Cubells, J.F., Kidd, J.R., Pakstis, A.J. and Kidd, K.K. (1999). Population Studies of Polymorphisms of the serotonin transporter protein gene. American Journal of Medical Genetics (Neuropsychiatric Genetics) 88: 61–66.

Greenberg, B.D.,  Tolliver, T.J., Huang, S.J. Li, Q., Bengel, D., &  Murphy D.L. (1999). 

Genetic variation in the serotonin transporter promoter region  affects serotonin uptake in human blood platelets. American Journal of Medical Genetics 88: 83-87.

Heils, A., A. Teufel, S. Petri, G. Stober, P. Riederer, D. Bengel, and K. P. Lesch.  (1996). Allelic Variation of the Human Serotonin Transporter Gene Expression.  Journal of Neurochemistry 66: 2621-2624.

Hu, X., Oroszi, G., Chun, J., Smith, T.L., Goldman,D., and Schuckit, M.A. (2005). An expanded evaluation of the relationship of four alleles to the level of response to alcohol and the alcoholism risk Alcoholism: Clinical and Experimental Research 29: 8-16.

Kaiser, R., Muller-Oerlinghausen, B., Filler, D., Tremblay, P. B., Berghofer, A., Roots, I., & Brockmoller, J. (2002)  Correlation between serotonin uptake in human blood platelets with  the 44-bp polymorphism and the 17-bp variable number of tandem repeat  of the serotonin transporter. American Journal of Medical Genetics 114: 323-328.

Lesch, K. P., Bengel, D., Heils, A., Sabol, S. Z., Greenberg, B. D., Petri, S., Benjamin, J., Muller, C. R., Hamer, D. H., and Murphy, D. L. (1996). Association of anxiety-related traits with a polymorphism in the serotonin transporter gene regulatory region. Science 274:1527–1531.

Lichter, J.B., Barr, C.L., Kenedy, J.L., Van Tol, H.H. M., Kidd, K.K., & Livak, K.J. (1993).  A hypervariable segment in the human dopamine receptor D4 (DRD4).  Human Molecular Genetics, 2: 767-773.

Nakamura, M.,  Ueno, S.,  Sano, A.  and Tanabe, H. (2000). The human serotonin transporter gene linked polymorphism (5-HTTLPR) shows ten novel allelic variants. Molecular Psychiatry 5: 32–38.

Nobile, M., Begni, B., Giorda, R., Frigerio, A., Marino, C., Molteni, M., Ferrarese, C., & Battaglia, M.J.  (1999). Effects of serotonin transporter promoter genotype on platelet serotonin transporter functionality in depressed children and adolescents. Journal of the American Academy of Child and Adolescent Psychiatry  38: 1396-1402.

Ramamoorthy, S., Bauman, A.L., Moore, K.R., Han, H., Yang-Feng, T.,Chang, A.S., Ganapathy, V. and Blakely, R. D. (1993). Antidepressant- and cocaine-sensitive human serotonin transporter: molecular cloning, expression, and chromosomal localization. Procedures of the  National Academy of  Sciences USA 90: 2542–2546.

Wendland, J.R., Martin, B.J., Kruse, M.R, Lesch, K.-P and  Murphy, D.L. (2006).Simultaneous genotyping of four functional loci of human SLC6A4, with a reappraisal of 5-HTTLPR and rs25531.
Molecular Psychiatry 11: 224-226.

Willeit, M., Stastny, J., Pirker, W., Praschak-Rieder, N., Neumeister, A., Asenbaum, S., Tauscher, J., Fuchs, K., Sieghart, W., Hornik, K., Aschauer, H.N., Brucke, T. and  Kasper, S. (2001)  No evidence for in vivo regulation of midbrain serotonin transporter  availability by serotonin transporter promoter gene polymorphism. Biological Psychiatry 50: 8-12.

Williams, R.B., Marchuk, D.A., Gadde, K.M., Barefoot, J.C., Grichnik, K., Helms, M.J., Kuhn, C.M., Lewis, J.G., Schanberg, S.M., Stafford-Smith, M., Suarez, E.C., Clary, G.L., Svenson, I.K. and Siegler, I.C. (2003).  Serotonin-related gene polymorphisms and central nervous system serotonin function. Neuropsychopharmacology  28: 533-541.